Forgot your password?
New user?
New Window Opens on the Secret Life of Microbes: Scientists Develop First Microbial Profiles of Ecosystems
CAS announces the release of SciFinder Scholar for Mac OS X
Press Releases
Press Releases
| Check out our New Publishers' Select for Free Articles |
Biochemical Pharmacology (v.70, #12)
Systems and integrative biology as alternative guises for pharmacology: Prime time for an iPharm concept? by Michael Williams (pp. 1707-1716).
Understanding the molecular basis of human disease pathophysiology is critical to accurate disease diagnosis, defining disease progression and to identifying new drugs that more specifically address target diseases. Advances in the understanding of tissue function (including draft maps of the human genome) coupled with industrial-scale, ‘enabling’ technologies like high throughput screening, combinatorial chemistry, proteomics, etc., have generated data on a scale never before possible. Despite this, there continues to be a dearth of new drug approvals ascribed to: (i) the challenges of working with novel, often non-validated disease targets; (ii) targeting diseases (stroke, Alzheimer's) with limited (if any) treatment and ill-defined clinical trial endpoints; (iii) enhanced regulatory hurdles for drug approval; (iv) insufficient time for the new knowledge and enabling technologies to have reached a productive level.An alternate viewpoint is that unfettered access to such technologies, where exclusion rather than integration has been the hallmark, has markedly reduced the intellectual competent of the biomedical research endeavor, with perceived technological ‘quick fixes’ displacing the integrative, hierarchical approach of pharmacology, that with medicinal chemistry, represents the core of the drug discovery process. After two decades of profound neglect, pharmacology has re-emerged as the key discipline in providing context to the drug discovery process, facilitating more timely, context-relevant and data-driven outcomes in the search for new drugs. Rather than viewing the future of drug discovery in terms of the ‘new’ biologies, systems and integrative, a rubric along the lines of iPharm, integrating both established and new technologies, is required.
Keywords: Pharmacology; Drug discovery; Integrative biology; Null hypothesis; iPharm
Specific adducts recognised by a monoclonal antibody against cisplatin-modified DNA by Emma L. Meczes; Ali Azim-Araghi; Christopher J. Ottley; D. Graham Pearson; Michael J. Tilby (pp. 1717-1725).
Numerous clinical or experimental studies have employed monoclonal antibody CP9/19 for quantification of cisplatin DNA adducts. The nature of adducts recognised by CP9/19 on polymeric DNA were defined using synthetic deoxynucleotides reacted with cisplatin. Total adduct levels were determined by atomic absorption spectrometry. The nature of adducts formed were confirmed by analysis of enzymatic hydrolysates using an established ion-exchange chromatography method combined with inductively coupled plasma mass spectrometry. Of the Pt bound to oligonucleotide A (TTTTTGGTTTTTGGTTTTTGGTTTTTGGTTTTT), 77% was recovered in a product consistent with the expected 1,2 intra-strand cross-link between GG. For oligonucleotide B (TTTTTAGTTTTTAGTTTTTAGTTTTTAGTTTTT), 62% of the bound Pt was recovered in a product consistent with the 1,2 intra-strand cross-link between AG. Of Pt bound to oligothymydylic acid, 65% was recovered in a product not previously described, small quantities of which were also formed on oligonucleotides A and B. The concentrations of adducts required to cause 50% reduction of signal in a competitive enzyme-linked immunosorbant assay (ELISA) ( K-values) were determined. Adducts on sequences containing no guanine or only non-adjacent guanine residues, including sequences containing adenines adjacent to guanines, exhibited low or undetectable immunoreactivities ( K-values=from 1 to >100pmoles Pt per assay well). Adducts formed on oligodeoxynucleotides containing guanine doublets interspersed amongst thymine residues were the most immunoreactive ( K-values: 2–7 fmoles adduct per assay well), comparable to adducts on calf-thymus DNA. The only cisplatin–DNA adducts recognised with high sensitivity by antibody CP9/19 were those involving adjacent guanine residues but immunorecognition of these was influenced by the surrounding DNA sequence.
Keywords: Cisplatin; DNA adduct; Immunoassay; Oligonucleotide; ICP-MS; Ion-exchange chromatography
Inhibition of interferon-γ signaling by a mercurio-substituted dihydropsoralen in murine keratinocytes by Christine A. Martey; Anna M. Vetrano; Marilyn S. Whittemore; Thomas M. Mariano; Diane E. Heck; Debra L. Laskin; Ned D. Heindel; Jeffrey D. Laskin (pp. 1726-1734).
Psoralens and ultraviolet light A (PUVA) are used in the treatment of a variety of epidermal proliferative and inflammatory disorders. These compounds are known to intercalate and photo crosslink DNA. Specific receptor proteins for psoralens have also been identified. We describe a novel activity of a thiol reactive derivative, iodomercurio-4′,5′-dihydrotrimethylpsoralen (iodomercurio-H2TMP) in keratinocytes. Without UVA, this psoralen was found to be an effective inhibitor of interferon-γ (IFN-γ)-signaling as measured by induction of nitric oxide biosynthesis (IC50=0.8μM). This activity was increased (IC50=0.1μM) when the cells were depleted of intracellular glutathione (GSH) with buthionine sulfoximine. In keratinocytes, IFN-γ stimulates expression of inducible nitric oxide synthase (NOS2). Although iodomercurio-H2TMP did not alter NOS2 enzymatic activity, it blocked IFN-γ-induced expression of NOS2 mRNA and protein, an effect that was enhanced in GSH-depleted cells. Iodomercurio-H2TMP was found to readily inhibit IFN-γ signaling in transient transfection assays using NOS2 promoter/luciferase reporter constructs. NOS2 gene expression is known to require a variety of transcription factors including STAT-1, NF-κB and AP-1. Using mobility shift assays the psoralen, at concentrations that inhibit nitric oxide biosynthesis, had no effect on the DNA binding activity of STAT-1 or NF-κB. However, iodomercurio-H2TMP was found to suppress AP-1. These data indicate that iodomercurio-H2TMP acts at sulfhydryl-sensitive sites to inhibit NOS2. Moreover, this is dependent on early events in the IFN-γ signal transduction pathway. Inhibition of AP-1 suggests that the psoralen functions by interfering with an important transcription factor that regulates expression of NOS2 in keratinocytes.
Keywords: Abbreviations; AP-1; activator protein-1; BSO; buthionine [; S; ,; R; ] sulfoximine; COX-2; cyclooxygenase-2; GAS; gamma-activated sequence; GSH; glutathione; IFN-γ; interferon-γ; Iodomercurio-H; 2; TMP; 4,8-dimethyl-5′-iodo-methyl-4′,5′-dihydropsoralen; MTS; 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium; NF-κB; nuclear factor kappa B; STAT-1; signal transducer and activator of transcription; TCA; trichloroacetic acid; TMP; 4,5′,8-trimethylpsoralen; UVA; ultraviolet light A (320–400; nm)Nitric oxide; PUVA; Interferon-γ; Psoriasis; Skin
Isothiazole dioxide derivative6n inhibits vascular smooth muscle cell proliferation and protein farnesylation by Nicola Ferri; Francesca Clerici; Kohei Yokoyama; Donato Pocar; Alberto Corsini (pp. 1735-1743).
Isothiazole dioxides have been shown to inhibit Trypanosoma brucei protein farnesyltransferase (PFTase) in isolated enzyme, but elicited only a minor effect on mammalian PFTase. In the present study we have evaluated the effect of 3-diethylamino-4-(4-methoxyphenyl)-isothiazole 1,1-dioxides with different substituents at C5, on rat PFTase and protein geranylgeranyltransferase-I (PGGTase-I) with the final aims to improve the potency against mammalian PFTase and to identify new compounds with antiproliferative properties. For these purposes, in vitro and cell culture models have been utilized. The results showed that isothiazole dioxides with C4–C5 double bond and sulfaryl substituted at the C5 position but none of the dihydro-derivatives, were able to inhibit in vitro PFTase in a concentration dependent manner (IC50 ranging from 8.56 to 1015μM). Among those, compound6n (C5; methyl-S) displayed 500-fold higher inhibitory potency on PFTase than PGGTase-I. Compound6n was shown to affect rat smooth muscle cell (SMC) proliferation at concentrations similar (IC50=61.4μM) to those required to inhibit [3H]-farnesol incorporation into cellular proteins (−44.1% at 100μM). Finally, compound6n interferes with rat SMC proliferation by blocking the progression of G0/G1 phase without inducing apoptosis, as assessed by [3H]-thymidine incorporation assay and flow cytometry analysis. Taken together, we described a new PFTase inhibitor containing the isothiazole dioxide moiety that affects mammalian protein farnesylation and SMC proliferation by inhibiting G0/G1 phase of the cell cycle.
Keywords: Abbreviations; FCS; fetal calf serum; FOH; farnesol; FPP; farnesyl pyrophoshate; GGOH; geranylgeraniol; GGPP; geranylgeranyl pyrophosphate; HMG-CoA; 3-hydroxy-3-methyl-glutaryl coenzyme A; MEM; minimum essential medium; MVA; mevalonate; PBS; phosphate buffered saline; PFTase; protein farnesyltransferase; PGGTase; protein geranylgeranyltransferase; PMSF; phenylmethylsulphonylfluoride; SMC; smooth muscle cellCell proliferation; Farnesylation; Farnesyl transferase inhibitor; Smooth muscle cell; Farnesol; Atherosclerosis
Excitatory amino acid transporters expressed by synovial fibroblasts in rats with collagen-induced arthritis by Eiichi Hinoi; Ryosuke Ohashi; Susumu Miyata; Yasuko Kato; Mika Iemata; Hironori Hojo; Takeshi Takarada; Yukio Yoneda (pp. 1744-1755).
Although previous studies have demonstrated increased levels of the brain neurotransmitter glutamate (Glu) in the synovial fluid from patients with arthritis, not much attention has been paid to the possible role of Glu in joint synovial tissues to date. Constitutive expression of mRNA was for the first time shown with glutamate aspartate transporter, glutamate transporter-1 and excitatory amino acid carrier-1 (EAAC1), in addition to with particular ionotropic and metabotropic Glu receptors, in cultured synovial fibroblasts prepared from knee joints of male Lewis rats. Immunohistochemical analysis revealed high localization of immunoreactive EAAC1 at synovial tissues. The accumulation of [3H]Glu occurred in a temperature- and sodium-dependent manner in cultured synovial fibroblasts, with a Km of 23.1±1.1μM and a Vmax of 237.1±31.1pmol/(mg proteinmin), respectively. In rats with arthritis induced by immunization to type-II collagen, marked increases were seen in hind paw volume, cytokine mRNA expression and Glu levels in synovial tissues, in addition to histological erosion. In cultured synovial fibroblasts prepared from these arthritic rats, [3H]Glu accumulation was drastically increased with biochemical and pharmacological profiles similar to those seen in normal synovial fibroblasts. The exposure to Glu at 500μM doubled the incorporation of 5-bromo-2′-deoxyuridine in cultured synovial fibroblasts of arthritic but not normal rats, without significantly affecting mRNA expression of different cytokines in both synovial fibroblasts. These results suggest that Glu may at least in part play a role in mechanisms associated with cellular proliferation through particular transporters functionally expressed by synovium in rheumatoid arthritis.
Keywords: Abbreviations; A.B.; Alcian Blue; AMPA; dl; -α-amino-3-hydroxy-5-methylisoxasole-4-propionate; BrdU; 5-bromo-2′-deoxyuridine; CIA; collagen-induced arthritis; EAAC1; excitatory amino acid carrier-1; EAAT; excitatory amino acid transporter; GAPDH; glyceraldehydes-3-phosphate dehydrogenase; GLAST; glutamate aspartate transporter; GLT-1; glutamate transporter-1; Glu; glutamate; H.E.; Hematoxylin and Eosin; HKR; Hepes-buffered Krebs-Ringer; iGluR; ionotropic glutamate receptor; IL-1β; interleukin-1β; KA; kainate; mGluR; metabotropic glutamate receptor; NMDA; N; -methyl-; d; -aspartate; PBS; phosphate-buffered saline; RANKL; receptor activator nuclear factor-κB ligand; RT-PCR; reverse transcription polymerase chain reaction; RA; rheumatoid arthritis; TNF-α; tumor necrosis factor-αEAATs; Glutamate; Rheumatoid arthritis; [; 3; H]glutamate accumulation; Cell proliferation; Synovial fibroblasts; GluRs
Expression profiles of various transporters for oligopeptides, amino acids and organic ions along the human digestive tract by Tomohiro Terada; Yutaka Shimada; Xiaoyue Pan; Koshiro Kishimoto; Takaki Sakurai; Ryuichiro Doi; Hisashi Onodera; Toshiya Katsura; Masayuki Imamura; Ken-ichi Inui (pp. 1756-1763).
Various transporters such as H+/peptide cotransporter PEPT1 are expressed in the intestine, and play important physiological and pharmacological roles in the body. Present study was performed to examine the expression profile of 20 kinds of transporters (PEPT1 and 2, P-glycoprotein, amino acid transporters and organic ion transporters) along the human digestive tract, especially focusing on PEPT1. Using normal mucosal specimens, real-time polymerase chain reactions were carried out. Immunoblot analyses were also performed for PEPT1 expression. PEPT1 mRNA was highly expressed in the small intestine (duodenum>jejunum>ileum) compared to other tissues, and some patients showed a significant level of expression in the stomach. The expressional pattern of PEPT1 in the stomach and histological diagnosis indicated that gastric PEPT1 originated from the intestinal metaplasia. The amino acid transporters showed unique mRNA expression levels and distributions in the digestive tract. For example, the expression levels of B0AT1, a Na+-dependent and chloride-independent neutral amino acid transporter, were increased from the duodenum to ileum, which pattern is completely inverted to that for PEPT1. There is little expression of organic ion transporters except for organic cation/carnitine transporter OCTN2. In conclusion, PEPT1 was abundantly expressed in the small intestine, and the reciprocal expression of PEPT1 and B0AT1 may serve for the efficient absorption of protein digestive products.
Keywords: Protein absorption; Digestive tract; Transporter; PEPT1; B; 0; AT1; OCTN2; Organic ion transporter
Lysophosphatidic acid stimulates cell proliferation in rat chondrocytes by Mi-Kyoung Kim; Ha-Young Lee; Kyoung Sun Park; Eun Ha Shin; Seong Ho Jo; Jeanho Yun; Sung Won Lee; Young Hyun Yoo; Yun-Sik Lee; Suk-Hwan Baek; Yoe-Sik Bae (pp. 1764-1771).
Rat primary chondrocytes express the lysophosphatidic acid (LPA) receptor, LPA1, LPA3, but not LPA2. When chondrocytes were stimulated with LPA, phospholipase C-mediated cytosolic calcium increase was dramatically induced. LPA also stimulated two kinds of mitogen-activated protein kinase, extracellular signal-regulated kinase (ERK) and p38 kinase in chondrocytes. In terms of the LPA-mediated functional modulation of chondrocytes, LPA stimulated cellular proliferation. We examined the signaling pathways involved in LPA-mediated cellular proliferation. LPA-induced chondrocyte proliferation was almost completely blocked by 2′-amino-3′-methoxyflavone (PD98059) but not by 4-(4-fluorophenyl)-2-(4-methylsulfinylphenyl)-5-(4-pyridyl)1 H-imidazole (SB203580), suggesting that ERK activity is essentially required for the process. Pertussis toxin almost completely inhibited the LPA-induced cellular proliferation and ERK activation, indicating the role of Gi/o protein(s) in the processes. This study demonstrates the physiological role of LPA on the modulation of rat primary chondrocyte proliferation, and the crucial role played by ERK in the process.
Keywords: Abbreviations; BAPTA/AM; 1,2-bis (aminophenoxy) ethane-; N; ,; N; ,; N; ′,; N; ′-tetraacetoxymethyl ester; [Ca; 2+; ]; i; intracellular calcium concentration; ECL; enhanced chemiluminescence; ERK; extracellular signal-regulated protein kinase; fura-2/AM; fura-2 pentaacetoxymethylester; GPCR; G-protein coupled receptor; IL-1β; interleukin-1β; LPA; lysophosphatidic acid; LY294002; 2-(4-Morpholinyl)-8-phenyl-4; H; -1-benzopyran-4-one; MAPK; mitogen-activated protein kinase; PD98059; 2′-amino-3′-methoxyflavone; pERK; phospho-ERK; PI3K; phosphatidylinositol-3-kinase; PLC; phospholipase C; pp38; phospho-p38; PTX; pertussis toxin; SB203580; 4-(4-fluorophenyl)-2-(4-methylsulfinylphenyl)-5-(4-pyridyl)1; H; -imidazole; sPLA; 2; secretory phospholipase A2; TCA; trichloroacetic acid; TNF-α; tumor necrosis factor-α; U-73122; 1-[6-((17β-3-methoxyestra-1,3,5(10)-trien-17-yl)amino)hexyl]-1; H; -pyrrole-2,5-dioneLysophosphatidic acid; Chondrocyte; Proliferation; Pertussis toxin-sensitive G-protein; Extracellular signal-regulated kinase
Inhibition of lipopolysaccharide-induced cyclooxygenase-2 transcription by 6-(methylsulfinyl) hexyl isothiocyanate, a chemopreventive compound from Wasabia japonica (Miq.) Matsumura, in mouse macrophages by Takuhiro Uto; Makoto Fujii; De-Xing Hou (pp. 1772-1784).
6-(Methylsulfinyl)hexyl isothiocyanate (6-MITC) is a chemopreventive compound occurring in Wasabi ( Wasabia japonica (Miq.) Matsumura), which is a very popular pungent spice in Japan. We investigated the effects of 6-MITC on the expression of cyclooxygenase-2 (COX-2) in lipopolysaccharide (LPS)-activated murine macrophage RAW264 cells. Treatment with 6-MITC suppressed LPS-mediated induction of COX-2 protein in a dose-dependent manner. Transfections with various COX-2 promoter reporter constructs revealed that the inhibitory effects of 6-MITC on COX-2 gene expression were directed by the core promoter elements including nuclear factor κB (NF-κB), CCAAT/enhancer-binding protein (C/EBP) and cyclic AMP-response element (CRE) sites. Western blotting analysis showed that 6-MITC inhibited LPS-induced activation of MAPK (ERK, p38 kinase and JNK) and transcriptional factors (CREB, c-Jun and C/EBPδ) binding the core elements of COX-2 promoter, substantiating the involvement of these signal transduction pathways in the regulation of COX-2 expression by 6-MITC. Moreover, Western blotting experiments with MAPK-specific inhibitors (U0126 for MEK1/2, SB203580 for p38 kinase and SP600125 for JNK) demonstrated that 6-MITC suppressed LPS-induced COX-2 expression by blocking the activation of JNK-mediated AP-1 and ERK/p38 kinase-mediated CREB or C/EBPδ. Finally, the structure–activity study revealed that the inhibitory potency of methylsulfinyl isothiocyanates (MITCs) depended on the methyl chain length. These findings demonstrate for the first time that 6-MITC is an effective agent to attenuate COX-2 production, and enhance our understanding of the anti-inflammation properties of 6-MITC.
Keywords: Abbreviations; AP-1; activator protein-1; C/EBP; CCAAT/enhancer-binding protein; COX; cyclooxygenase; CRE; cyclic AMP-response element; CREB; CRE binding protein; ERK; extracellular signal-regulated kinase 1/2; JNK; c-Jun NH; 2; -terminal kinase; LPS; lipopolysaccharide; MAPK; mitogen-activated protein kinase; 6-MITC; 6-(methylsulfinyl)hexyl isothiocyanate; NF-κB; nuclear factor κB6-(Methylsulfinyl)hexyl isothiocyanate; Cyclooxygenase-2; Lipopolysaccharide; Mitogen-activated protein kinase; Macrophage
Role of mechanical and redox stress in activation of mitogen-activated protein kinases in primary cultured rat hepatocytes by Sang K. Kim; Kimberley J. Woodcroft; Soo Jin Oh; Mohamed A. Abdelmegeed; Raymond F. Novak (pp. 1785-1795).
Mechanical stress is known to activate signaling cascades, including mitogen-activated protein kinase (MAPK) pathways. Although mechanical stress has been implicated in hepatic cirrhosis and liver regeneration following hepatectomy, the signaling pathway(s) that may be activated in hepatocytes in response to mechanical stress have not been determined. Using primary cultured rat hepatocytes to examine cellular signaling in response to mechanical stress associated with medium change, we observed that the phosphorylation status of extracellular signal-regulated kinase 1/2 (ERK1/2), Jun N-terminal kinase and p38 MAPK, but not Akt, was altered. MAPK activation, especially ERK1/2, was rapidly increased within 5min, followed by a subsequent decrease to below basal levels between 30min and 1h following medium change. MAPK/ERK kinase (MEK1/2) phosphorylation followed the same pattern. The phosphorylation of Raf-1 in response to medium change was also consistent with Raf-1 serving as an upstream regulator of MEK1/2-ERK1/2 signaling. Phosphorylation of ERK1/2 was increased by mechanical stress alone, suggesting that mechanical stress may be primarily responsible for ERK1/2 activation in response to medium change. Medium change produced a marked decline in oxidized glutathione and malondialdehyde levels, and the antioxidant N-acetyl-l-cysteine decreased basal ERK1/2 phosphorylation, suggesting a role for oxidative stress in maintaining basal ERK1/2 phosphorylation in cultured hepatocytes. These data suggest that medium change results in immediate activation of the MAPK signaling pathway due to mechanical stress, followed by a subsequent inactivation of MAPK signaling due to a reduction in oxidative stress levels. These processes may be associated with alteration of hepatic hemodynamic circulation observed in hepatic diseases and in liver transplantation.
Keywords: Abbreviations; MAPK; mitogen-activated protein kinase; ERK; extracellular signal-regulated kinase; JNK; Jun N-terminal kinase; MEK; MAPK/ERK kinase; GSH; total glutathione; GSSG; GSH disulfide; NAC; N; -acetyl-; l; -cysteine; EGF; epidermal growth factor; MDA; malondialdehyde; TOSC; total oxy-radical scavenging capacity; HBSS; Hanks’ balanced salt solutionMechanical stress; Oxidative stress; Signaling pathways; ERK1/2; Hepatocytes
Mitochondria-targeted peptide prevents mitochondrial depolarization and apoptosis induced by tert-butyl hydroperoxide in neuronal cell lines by Kesheng Zhao; Guoxiong Luo; Serena Giannelli; Hazel H. Szeto (pp. 1796-1806).
Oxidative stress and mitochondrial oxidative damage have been implicated in aging and many common diseases. Mitochondria are a primary source of reactive oxygen species (ROS) in the cell, and are particularly susceptible to oxidative damage. Oxidative damage to mitochondria results in mitochondrial permeability transition (MPT), mitochondrial depolarization, further ROS production, swelling, and release of cytochrome c (cyt c). Cytosolic cyt c triggers apoptosis by activating the caspase cascade. In the present work, we examined the ability of a novel cell-penetrating, mitochondria-targeted peptide antioxidant in protecting against oxidant-induced mitochondrial dysfunction and apoptosis in two neuronal cell lines. Treatment with tert-butyl hydroperoxide ( tBHP) for 24h resulted in lipid peroxidation and significant cell death via apoptosis in both N2A and SH-SY5Y cells, with phosphatidylserine translocation, nuclear condensation and increased caspase activity. Cells treated with tBHP showed significant increase in intracellular ROS, mitochondrial depolarization and reduced mitochondrial viability. Concurrent treatment with <1nM SS-31 (D-Arg-Dmt-Lys-Phe-NH2; Dmt=2′,6′-dimethyltyrosine) significantly decreased intracellular ROS, increased mitochondrial potential, and prevented tBHP-induced apoptosis. The remarkable potency of SS-31 can be explained by its extensive cellular uptake and selective partitioning into mitochondria. Intracellular concentrations of [3H]SS-31 were 6-fold higher than extracellular concentrations. Studies using isolated mitochondria revealed that [3H]SS-31 was concentrated ∼5000-fold in the mitochondrial pellet. By concentrating in the inner mitochondrial membrane, SS-31 is localized to the site of ROS production, and can therefore protect against mitochondrial oxidative damage and further ROS production. SS-31 represents a novel platform of mitochondria-targeted antioxidants with broad therapeutic potential.
Keywords: Abbreviations; cyt; c; cytochrome; c; DCF; dichlorofluorescein; Dmt; 2′,6′-dimethyltyrosine; 4-HNE; 4-hydroxynonenol; LDH; lactate dehydrogenase; MPT; mitochondrial permeability transition; ROS; reactive oxygen species; SS-31; D-Arg-Dmt-Lys-Phe-NH; 2; t; BHP; tert; -butyl hydroperoxide; TMRM; tetramethylrhodamine methyl esterOxidative stress; Mitochondrial permeability transition; Reactive oxygen species; Antioxidant; Cell-penetrating cationic peptides
Isolation and characterisation of acanmyotoxin-2 and acanmyotoxin-3, myotoxins from the venom of the death adder Acanthophis sp. Seram by Andrew J. Hart; A. Ian Smith; Shane Reeve; Wayne C. Hodgson (pp. 1807-1813).
Death adder (genus Acanthophis) venoms display neurotoxic activity but were thought to be devoid of myotoxic components. Studies from our laboratory have shown that some species (i.e. Acanthophis rugosus and Acanthophis sp. Seram) posses venom with myotoxic activity [Wickramaratna JC, Fry BG, Aguilar M, Kini RM, Hodgson WC. Isolation and pharmacological characterisation of a phospholipase A2 myotoxin from the venom of the Irian Jayan death adder ( A. rugosus). Br J Pharmacol 2003;138:333–342; Wickramaratna JC, Fry BG, Hodgson WC. Species-dependent variations in the in vitro myotoxicity of death adder ( Acanthophis) venoms. Toxicol Sci 2003;74:352–360]. The present study describes the isolation and characterisation of two myotoxins (acanmyotoxin-2 and acanmyotoxin-3) from A. sp. Seram venom. Venom was fractionated into approximately 12 major peaks using reverse phase high performance liquid chromatography. Two components caused concentration (0.1–1μM) dependent inhibition of direct (2ms, 0.1Hz, supramaximal V) twitches and an increase in baseline tension in the chick biventer cervicis nerve-muscle. Histological examination of the muscle confirmed damage. PLA2 activity was detected in both acanmyotoxin-2 (390.2±19.7μmol/(minmg); n=4) and acanmyotoxin-3 (14.2±7.7μmol/(minmg); n=4). In comparison, A. sp. Seram whole venom had a specific activity of 461.3±90.4μmol/(minmg) ( n=3). Mass spectrometry analysis indicated acanmyotoxin-2 had a mass of 13,082Da and acanmyotoxin-2 13,896Da. Acanmyotoxin-2 and acanmyotoxin-3 accounted for approximately 7 and 4% of total venom composition, respectively. N-terminal sequencing of the first 30 amino acids of each toxin indicated they shared some sequence homology with known myotoxins. In conclusion, clinicians should be aware that symptoms of envenoming by some species of death adder may include signs of myotoxicity as well as neurotoxicity. Future studies will investigate the efficacy of the current antivenom treatment against the myotoxic components of A. sp. Seram venom.
Keywords: Death adder; Acanthophis; Acanmyotoxin; Myotoxin; Chick biventer cervicis nerve-muscle; Phospholipase A; 2; Venom
Hypoxia impedes the formation of chromium DNA-adducts in a cell-free system by Travis J. O’Brien; H. George Mandel; Kent D. Sugden; Andrei M. Komarov; Steven R. Patierno (pp. 1814-1822).
The metabolic reduction of hexavalent chromium [Cr(VI)] in the presence of DNA generates several lesions which impede DNA replication and gene transcription. However, the relative contribution of molecular oxygen to Cr-induced genetic damage is unclear. To elucidate the role of dioxygen in Cr genotoxicity, we studied the formation of Cr-induced lesions in DNA treated with either Cr(VI) and the physiological reductant, ascorbic acid (Asc), or Cr(III), under ambient and hypoxic (<1% oxygen) conditions. We found that hypoxia did not impede the reduction of Cr(VI) by Asc throughout a 2h treatment. In contrast, Cr-DNA binding under these conditions was reduced up to 70% by hypoxia, and a 50–90% decrease in the frequency of Cr-induced Taq polymerase-arresting DNA adducts was also observed. In the presence of Cr(VI)/Asc, formation of Cr-DNA interstrand crosslinks (ICLs) under hypoxia was 50% or less of that under ambient conditions. Kinetic studies found that hypoxia reduced the rate at which Cr interacted with DNA, but not the ultimate steady state level of Cr-DNA binding. The inhibitory effect of hypoxia on Cr(VI)/Asc genotoxicity could not be explained solely by alterations in the reactivity of intermediate Cr(V) species because Cr(III)-DNA binding and Cr(III)-induced ICL formation were also impaired by hypoxia. Moreover, Cr(V) was generated to similar levels in ambient and hypoxic reactions. Hypoxia did not affect ICL formation by the inorganic chemotherapeutic agent cisplatin, suggesting that these effects were specific for Cr(III). Taken together, these results support a role for dioxygen in facilitating the formation of Cr-DNA coordination complexes.
Keywords: Chromium; Oxygen; Hypoxia; Cisplatin; DNA adducts
Association between tubular toxicity of cisplatin and expression of organic cation transporter rOCT2 (Slc22a2) in the rat by Atsushi Yonezawa; Satohiro Masuda; Kumiko Nishihara; Ikuko Yano; Toshiya Katsura; Ken-ichi Inui (pp. 1823-1831).
Cisplatin is an effective anticancer drug, but has its severe adverse effects, especially nephrotoxicity. The molecular mechanism of cisplatin-induced nephrotoxicity is still not clear. In the present study, we examined the role of rat (r)OCT2, an organic cation transporter predominantly expressed in the kidney, in the tubular toxicity of cisplatin. Using HEK293 cells stably expressing rOCT2 (HEK-rOCT2), we evaluated the cisplatin-induced release of lactate dehydrogenase and the uptake of cisplatin. The release of lactate dehydrogenase and the accumulation of platinum were greater in HEK-rOCT2 cells treated with cisplatin than in mock-transfected cells. Moreover, cimetidine and corticosterone, OCT2 inhibitors, inhibited the cytotoxicity and the transport of cisplatin in HEK-rOCT2 cells. Pharmacokinetics of cisplatin was investigated in male and female rats because the renal expression level of rOCT2 was higher in male than female rats. The renal uptake clearance of cisplatin was greater in male than female rats, while the hepatic uptake clearance was similar between the sexes. In addition, glomerular filtration rate and liver function were unchanged, but N-acetyl-β-d-glucosaminidase activity in the bladder urine and the urine volume were markedly increased 2 days after the administration of 2mg/kg of cisplatin in male rats. Moreover, cisplatin did not induce the elevation of urinary N-acetyl-β-d-glucosaminidase activity in the castrated male rats whose renal rOCT2 level was lower than that of the sham-operated rats. In conclusion, the present results indicated that renal rOCT2 expression was the major determinant of cisplatin-induced tubular toxicity.
Keywords: Cisplatin; Organic cation transporter 2; Nephrotoxicity; Cytotoxicity; Renal tubular epithelial cells; Pharmacokinetics
Transport deficient (TR−) hyperbilirubinemic rats are resistant to acetaminophen hepatotoxicity by Vanessa M. Silva; Michael S. Thibodeau; Chuan Chen; José E. Manautou (pp. 1832-1839).
The biliary excretion of acetaminophen (APAP) is reduced in transport deficient (TR−) hyperbilirubinemic rats lacking the multidrug resistance-associated protein 2 (Mrp2). This mutant strain of Wistar rats has impaired biliary excretion of organic anions and increased hepatic glutathione. The rational for this study was to determine if there is an altered risk for liver damage by APAP in the absence of Mrp2. Therefore, the susceptibility of TR− rats to APAP hepatotoxicity was investigated. Male Wistar and TR− rats were fasted overnight before APAP treatment (1g/kg). Hepatotoxicity was assessed 24h later by plasma sorbitol dehydrogenase activity and histopathology. In other studies, TR− rats received buthionine sulfoximine before APAP to reduce hepatic glutathione to values similar to those in Wistar rats. mRNA expression of APAP metabolizing enzymes was also measured in naïve animals. Wistar rats treated with APAP showed significant elevations in plasma sorbitol dehydrogenase activity, while no increases in enzyme activity were observed in TR− rats. Histopathology was in agreement. Hepatic non-protein sulfhydryls were significantly lower in Wistar rats receiving APAP than in TR− rats. TR− rats treated with buthionine sulfoximine and APAP showed dramatic increases in hepatotoxicity. TR− rats had increased mRNA expression of several APAP metabolizing enzymes. Mrp2 expression not only is important in biliary excretion, but also influences the toxic potential of reactive intermediates by controlling intrahepatic GSH and possibly drug metabolism.
Keywords: Abbreviations; TR; −; transport deficient hyperbilirubinemic rats; Mrp; multidrug resistance-associated protein; APAP; acetaminophen; APAP-GSH; acetaminophen glutathione; APAP-GLUC; acetaminophen glucuronide; ICG; indocyanine green; NAPQI; N; -acetyl-; p; -benzoquinoneimine; SDH; sorbitol dehydrogenase; NPSH; non-protein sulfhydryls; BSO; buthionine sulfoximine; GSH; glutathione; PBS; phosphate buffered saline; γ-GCS; gamma-glutamylcysteine synthetase; UGT; UDP-glucuronosyltransferase; CYP450; cytochrome P450Acetaminophen; Mrp2; TR; −; rat; Liver; Biliary; Hepatotoxicity
Role of protein turnover in the activation of p38 mitogen-activated protein kinase in rat pinealocytes by A.K. Ho; L. McNeil; D. Terriff; D.M. Price; C.L. Chik (pp. 1840-1850).
Differences in the time profiles of activation between p38MAPK and p42/44MAPK by norepinephrine (NE) in rat pinealocytes suggest involvement of mechanisms other than the phosphorylation cascades in their activation. In the present study we investigated whether protein turnover played a role in regulating p38MAPK activation in the rat pineal gland. NE stimulation caused an increase in MAPK kinase3/6 (MKK 3/6) and p38MAPK phosphorylation that occurred in the absence of changes in the mRNA or protein levels of p38MAPK or MKK3/6. The stimulatory effect of NE on phosphorylated MKK3/6 and p38MAPK, but not phosphorylated p42/44MAPK, was blocked by treatment with actinomycin or cycloheximide, indicating a requirement of transcription and translation in activation of the p38MAPK but not the p42/44MAPK pathway. Moreover, inhibition of proteasomes by clasto-lactacystin β-lactone or Z-Leu-Leu-Leu-CHO (MG132) selectively increased basal and NE-stimulated phosphorylated MKK3/6 and p38MAPK levels without affecting the mRNA or protein levels of MKK3 or p38MAPK. In contrast, the effect of proteasomal inhibition on NE-stimulated p42/44MAPK phosphorylation was inhibitory. Treatment with MG132 also reduced the decline in the phosphorylated levels of NE-stimulated MKK3/6 and p38MAPK that normally follows β-adrenergic blockade. Together, our results indicate that p38MAPK but not p42/44MAPK activation in the rat pineal gland is tightly coupled to protein synthesis and degradation. The synthesis of an activator upstream of MKK3/6 is required for the NE-activation of p38MAPK.
Keywords: Abbreviations; AA-NAT; arylalkylamine-; N; -acetyltransferase; Actin; actinomycin; c-lact; clasto-lactacystin β-lactone; Cyclo; cycloheximide; DMEM; Dulbecco's modified Eagle's medium; GAPDH; glyceraldehyde-3-phosphate-dehydrogenase; JNK; c-Jun amino terminal kinase; MAPK; mitogen-activated protein kinase; MKP-1; MAPK phosphatase 1; MKK; MAPK kinase; NE; norepinephrine; p-MAPK; phosphorylated MAPK; MG132; Z-Leu-Leu-Leu-CHO; PKA; protein kinase Ap38MAPK; p42/44MAPK; Proteasome; Norepineprhine; Pineal
Drug specificity and intestinal membrane localization of human organic cation transporters (OCT) by Johanna Müller; Katrin S. Lips; Linda Metzner; Reinhard H.H. Neubert; Hermann Koepsell; Matthias Brandsch (pp. 1851-1860).
This study was performed to investigate which human organic cation transporter, hOCT1, hOCT2 or hOCT3, participates with regard to cation specificity and membrane localization in the intestinal absorption of orally available cationic drugs. Inhibition of N-[methyl-3H]4-phenylpyridinium ([3H]MPP+) uptake by various compounds into Caco-2 cells and into cells (HEK-293 or CHO) that were stably transfected with hOCT1, hOCT2 or hOCT3 was compared. The uptake of [3H]MPP+ into Caco-2 cells was inhibited by atropine, butylscopolamine, clonidine, diphenhydramine, etilefrine, quinine and ranitidine with IC50 values between 6μM and 4mM. Transepithelial, apical to basal flux of [3H]MPP+ across Caco-2 cell monolayers was also strongly inhibited by these compounds. The inhibitory potency of the cationic drugs and prototypical organic cations at Caco-2 cells correlated well with the inhibitory potency measured at CHO-hOCT3 cells but much less with that at HEK-hOCT1 and -hOCT2 cells. This is functional evidence for the predominant role of hOCT3. Etilefrine and atropine were specifically transported into CHO cells by hOCT3. In Caco-2 cells, the mRNA of all three hOCT and the proteins hOCT2 and hOCT3 were detected. More importantly, immunocytochemical analyses of human jejunum revealed for the first time that hOCT3 is localized to the brush border membrane whereas hOCT1 immunolabeling was mainly observed at the lateral membranes of the enterocytes.
Keywords: Abbreviations; ATRP; Atropine; BUTS; Butylscopolamine; CLON; Clonidine; DIPH; Diphenhydramine; MPP; +; N; -Methyl-4-phenylpyridinium; QUID; Quinidine; QUIN; Quinine; RANT; Ranitidine; hOCT; Human organic cation transporter(s); CE; Capillary electrophoresis; HEPES; 4-(2-(Hydroxyethyl)-piperazine)-1-sulfonic acid; Tris; Tris(hydroxymethyl)aminomethanchlorideDrug transport; Cationic therapeutic drugs; OCT3; Intestine; Caco-2 cells; Stably transfected cell lines
The binding of xanthone derivatives to transthyretin by Filipe Maia; Maria do Rosário Almeida; Luís Gales; Anake Kijjoa; Madalena M.M. Pinto; Maria J. Saraiva; Ana M. Damas (pp. 1861-1869).
A series of xanthone derivatives, isolated from Calophyllum teysmannii var. inophylloide, have been evaluated for their binding affinity to transthyretin. Transthyretin is a plasma protein involved in the transport of thyroxine (T4) and also implicated in amyloid diseases. Using competition-binding studies with the protein natural ligand T4, we have identified one prenylated xanthone with a very strong affinity to transthyretin. Molecular docking simulations show that the flexible tail of the prenylated xanthone could allow favorable molecular interactions. Since this xanthone may play a role in the thyroxine metabolism and/or over the pathogenic process associated with the amyloid disease, these results may be explored for the design of new ligands.
Keywords: Abbreviations; NSAID; non-steroidal anti-inflammatory drugs; T4; thyroxine; TBG; thyroxine-binding globulin; TTR; transthyretinTransthyretin; Amyloid; Competition-binding studies; Docking simulation; Binding affinity; Xanthone
Kinetics of tienilic acid bioactivation and functional generation of drug–protein adducts in intact rat hepatocytes by M. Pilar López-García; Patrick M. Dansette; Julio Coloma (pp. 1870-1882).
Drug-induced autoimmune hepatitis is among the most severe hepatic idiosyncratic adverse drug reactions. Considered multifactorial, the disease combines immunological and metabolic aspects, the latter being to date much better known. As for many other model drugs, studies on tienilic acid (TA)-induced hepatitis have evidenced the existence of bioactivation during the hepatic oxidation of the drug, allowing the identification of the neoantigen of anti-LKM2 autoantibodies and the pathway responsible for its formation. However, most of these results are based on the use of microsomal fractions whose relevance to the liver in vivo still needs to be established. In the more complex intact cell environment, several endogenous processes may play a significant role on triggering the reaction and should therefore be considered. In this work we have characterised the kinetics of TA biotransformation in metabolically competent hepatocytes, the influence of TA bioactivation on physiological GSH levels, and the qualitative and quantitative profile of drug–protein conjugates generated in situ, as a function of exposure time. Results confirm that intact hepatocytes reproduce in vitro the metabolic sequence that leads to the functional generation of drug–protein adducts, in conditions that simulate clinical human exposure to TA. Metabolically competent cultured hepatocytes appear as a very promising approach to investigate the early preimmunological events of drug-induced autoimmune hepatitis, adequate to identify the conditions that may modulate the formation and specificity of drug–protein adducts in vivo, to study the hepatic disposition of the TA-protein targets, and to define the specific role of the hepatocyte in the origin of this adverse reaction.
Keywords: Abbreviations; CYP; cytochrome P 450; l; -NAME; N; G; -nitro-; l; -argininine methyl ester; TA; 2,3-dichloro 4-(2-thienyl carbonyl) phenoxyacetic acid, tienilic acid; TBS; 50; mM Tris–HCl/150; mM KCl/1; mM EDTA buffer, pH 7.4Primary cultured hepatocytes; CYP; Tienilic acid; Drug bioactivation; Glutathione; Drug–protein adducts
Role of elevated S-adenosylhomocysteine in rat hepatocyte apoptosis: Protection by betaine by Kusum K. Kharbanda; David D. Rogers II; Mark E. Mailliard; Gerri L. Siford; Anthony J. Barak; Harriet C. Beckenhauer; Michael F. Sorrell; Dean J. Tuma (pp. 1883-1890).
Previous studies from our laboratory have shown that ethanol consumption results in an increase in hepatocellular S-adenosylhomocysteine levels. Because S-adenosylhomocysteine is a potent inhibitor of methylation reactions, we propose that increased intracellular S-adenosylhomocysteine levels could be a major contributor to ethanol-induced pathologies. To test this hypothesis, hepatocytes isolated from rat livers were grown on collagen-coated plates in Williams’ medium E containing 5% FCS and exposed to varying concentrations of adenosine in order to increase intracellular S-adenosylhomocysteine levels. We observed increases in caspase-3 activity following exposure to adenosine. This increase in caspase activity correlated with increases in intracellular S-adenosylhomocysteine levels and DNA hypoploidy. The adenosine-induced changes could be significantly attenuated by betaine administration. The mechanism of betaine action appeared to be via the methylation reaction catalyzed by betaine-homocysteine-methyltransferase. To conclude, our results indicate that the elevation of S-adenosylhomocysteine levels in the liver by ethanol is a major factor in altering methylation reactions and in increasing apoptosis in the liver. We conclude that ethanol-induced alteration in methionine metabolic pathways may play a crucial role in the pathologies associated with alcoholic liver injury and that betaine administration may have beneficial therapeutic effects.
Keywords: Hepatocytes; S-adenosylhomocysteine; Adenosine; Betaine; Methylation; Apoptosis